PX851
(Plasmid #62883)

• Purpose: N-term SpCas9 piece of inducible split-4 (Cas9(N)-FRB-NES split-4).
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149.

Backbone

• Vector backbone: PX330
• Backbone manufacturer: Zhang lab
• Backbone size w/o insert (bp): 4222
• Total vector size (bp): 6181
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SpCas9 (aa 2-535)
• Insert Size (bp): 1959
• Promoter: CBh
• Tags / Fusion Proteins:
  • NES PTK2 (N terminal on insert)
  • FRB (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: ctggagcacctgcctgaaatcact�
• 3′ sequencing primer: GGCTGATCAGCGAGCTCTAG�

Resource Information

• Supplemental Documents:
  • PX851 annotated sequence
• A portion of this plasmid was derived from a plasmid made by: SpCas9 piece was PCR amplified of PX330
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry