pGoldyTALEN-VIM-TAL-1
(Plasmid
#62855)
-
PurposeTALEN mediated gene editing at human VIM locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5563
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN array
-
SpeciesSynthetic
-
Insert Size (bp)1508
- Promoter miniCAGG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer catcgcgcaatgcactgac
- 3′ sequencing primer attcagatttcactagctgggatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCGS652 from the Voytas lab was used for Golden Gate assembly.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGoldyTALEN-VIM-TAL-1 was a gift from Gaudenz Danuser (Addgene plasmid # 62855 ; http://n2t.net/addgene:62855 ; RRID:Addgene_62855) -
For your References section:
Vimentin Intermediate Filaments Template Microtubule Networks to Enhance Persistence in Cell Polarity and Directed Migration. Gan Z, Ding L, Burckhardt CJ, Lowery J, Zaritsky A, Sitterley K, Mota A, Costigliola N, Starker CG, Voytas DF, Tytell J, Goldman RD, Danuser G. Cell Syst. 2016 Sep 21. pii: S2405-4712(16)30262-9. doi: 10.1016/j.cels.2016.08.007. 10.1016/j.cels.2016.08.007 PubMed 27667364