Skip to main content
Addgene

pclbw-opa1(isoform 7DeltaS1)-myc
(Plasmid #62846)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62846 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pclbw
  • Backbone manufacturer
    gifted by C. Lois and D. Baltimore
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mmOPA1isoform7 DeltaS1 - myc
  • Alt name
    mouse OPA1 isoform 7 Delta S1 fused to C-terminal myc tag
  • Alt name
    optic atrophy 1
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Opa1 (a.k.a. 1200011N24Rik, lilr3, mKIAA0567)
  • Promoter cmv-bactin
  • Tag / Fusion Protein
    • 9xMyc (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer AGCAGCGTATCCACATAGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pclbw-opa1(isoform 7DeltaS1)-myc was a gift from David Chan (Addgene plasmid # 62846 ; http://n2t.net/addgene:62846 ; RRID:Addgene_62846)

  • For your References section:

    Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Mishra P, Carelli V, Manfredi G, Chan DC. Cell Metab. 2014 Apr 1;19(4):630-41. doi: 10.1016/j.cmet.2014.03.011. 10.1016/j.cmet.2014.03.011 PubMed 24703695
Related items:
Commonly requested with: