pPBC-G6s
(Plasmid #62812)

• Purpose: pPBC-G6s expresses PiggyBac inverted terminal repeat-flanked GCaMP6s under the control of the CAG promoter.
• Depositing Lab: Karen Wilcox
• Publication: Gee et al Front Mol Neurosci. 2015 Apr 15;8:10. doi: 10.3389/fnmol.2015.00010. eCollection 2015.

Backbone

• Vector backbone: pSP72
• Backbone manufacturer: Promega Corporation
• Backbone size w/o insert (bp): 2462
• Total vector size (bp): 6998
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ITR-CAG-GCaMP6s-ITR
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: ATACGACAATCTCACAGACAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GCaMP6s was obtained from pGP-CMV-GCaMP6s (Addgene Plasmid #40753).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry