Skip to main content
Addgene

pPBC-LG3-tdT
(Plasmid #62810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62810 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSP72
  • Backbone manufacturer
    Promega Corporation
  • Backbone size w/o insert (bp) 2462
  • Total vector size (bp) 9158
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITR-CAG-Lck-GCaMP3-IRES-tdTomato-ITR
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer ATACGACAATCTCACAGACAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP3 was obtained from G-CaMP3 (Addgene Plasmid #22692). Lck was obtained from pN1-Lck-GCaMP2 (Addgene Plasmid #24794). IRES-tdTomato was obtained from Lara Carroll (Mario Capecchi Laboratory).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPBC-LG3-tdT was a gift from Karen Wilcox (Addgene plasmid # 62810 ; http://n2t.net/addgene:62810 ; RRID:Addgene_62810)
  • For your References section:

    Imaging activity in astrocytes and neurons with genetically encoded calcium indicators following in utero electroporation. Gee JM, Gibbons MB, Taheri M, Palumbos S, Morris SC, Smeal RM, Flynn KF, Economo MN, Cizek CG, Capecchi MR, Tvrdik P, Wilcox KS, White JA. Front Mol Neurosci. 2015 Apr 15;8:10. doi: 10.3389/fnmol.2015.00010. eCollection 2015. 10.3389/fnmol.2015.00010 PubMed 25926768