pBabe-ER-E2F2-dRb
(Plasmid #62805)

• Purpose: expresses an inducible E2F2 mutant that lacks the Rb binding domain
• Depositing Lab: Gerardo Ferbeyre
• Publication: Vernier et al Genes Dev. 2011 Jan 1;25(1):41-50. doi: 10.1101/gad.1975111.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 5200
• Total vector size (bp): 7066
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E2F2
• Alt name: E2F transcription factor 2
• Species: H. sapiens (human)
• Insert Size (bp): 900
• Mutation: deletion of amino acids 302-437, including the Rb binding domain
• GenBank ID:
• Entrez Gene: E2F2 (a.k.a. E2F-2)
• Tag / Fusion Protein:
  • HA-Er (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ctttatccagccctcac
• 3′ sequencing primer: ggaatgtgtgtcagttagggt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr K. Helin. Department of Experimental Oncology, European Institute of Oncology, 20141 Milan, Italy

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBABE-ER-E2Fs were
gifts from Dr. K. Helin