Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBabe-ER-E2F2-dRb
(Plasmid #62805)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62805 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 7066
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E2F2
  • Alt name
    E2F transcription factor 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    900
  • Mutation
    deletion of amino acids 302-437, including the Rb binding domain
  • GenBank ID
  • Entrez Gene
    E2F2 (a.k.a. E2F-2)
  • Tag / Fusion Protein
    • HA-Er (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer ggaatgtgtgtcagttagggt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr K. Helin. Department of Experimental Oncology, European Institute of Oncology, 20141 Milan, Italy

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBABE-ER-E2Fs were
gifts from Dr. K. Helin

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-ER-E2F2-dRb was a gift from Gerardo Ferbeyre (Addgene plasmid # 62805 ; http://n2t.net/addgene:62805 ; RRID:Addgene_62805)
  • For your References section:

    Regulation of E2Fs and senescence by PML nuclear bodies. Vernier M, Bourdeau V, Gaumont-Leclerc MF, Moiseeva O, Begin V, Saad F, Mes-Masson AM, Ferbeyre G. Genes Dev. 2011 Jan 1;25(1):41-50. doi: 10.1101/gad.1975111. 10.1101/gad.1975111 PubMed 21205865