-
PurposeExpresses Cre recombinase protein in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-15
- Backbone size w/o insert (bp) 5646
- Total vector size (bp) 6786
-
Vector typeBacterial Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
SpeciesP1 Bacteriophage
-
Insert Size (bp)1134
-
MutationCodon optimazed for e.coli
- Promoter T7
-
Tags
/ Fusion Proteins
- His tag (N terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GATCGAGATCTCGATCCCGCG
- 3′ sequencing primer TTTCAGCAAAAAACCCCTCAAGACC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRE recombinase was a gift from Niels Geijsen (Addgene plasmid # 62730 ; http://n2t.net/addgene:62730 ; RRID:Addgene_62730) -
For your References section:
Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214