Skip to main content
Addgene

CRE recombinase
(Plasmid #62730)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62730 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-15
  • Backbone size w/o insert (bp) 5646
  • Total vector size (bp) 6786
  • Vector type
    Bacterial Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Species
    P1 Bacteriophage
  • Insert Size (bp)
    1134
  • Mutation
    Codon optimazed for e.coli
  • Promoter T7
  • Tags / Fusion Proteins
    • His tag (N terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATCGAGATCTCGATCCCGCG
  • 3′ sequencing primer TTTCAGCAAAAAACCCCTCAAGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRE recombinase was a gift from Niels Geijsen (Addgene plasmid # 62730 ; http://n2t.net/addgene:62730 ; RRID:Addgene_62730)
  • For your References section:

    Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214