pCas9–mKate2ps–T1gRNA
(Plasmid
#62717)
-
Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTag-CFP
- Total vector size (bp) 9474
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9–mKate2ps
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Discrepancies between the full and QC sequence are of no functional consequence.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9–mKate2ps–T1gRNA was a gift from Leonidas Bleris (Addgene plasmid # 62717 ; http://n2t.net/addgene:62717 ; RRID:Addgene_62717) -
For your References section:
CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Moore R, Spinhirne A, Lai MJ, Preisser S, Li Y, Kang T, Bleris L. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. 10.1093/nar/gku1326 PubMed 25527740
Map uploaded by the depositor.
