LentiCRISPR_Hs_MBD3_ex2
(Plasmid
#62623)
-
PurposeEncodes gRNA which targets human MBD3
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR
-
Backbone manufacturerZhang lab
- Backbone size w/o insert (bp) 13450
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBD3 gRNA
-
gRNA/shRNA sequenceCTTGCCCGTGCGGAAGTCGA
-
SpeciesH. sapiens (human)
-
Entrez GeneMBD3
- Promoter EFS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hU6-F (for gRNA)
- 3′ sequencing primer hSpCas9-R1 5'-CGCTCGTGCTTCTTATCCTC (for Cas9) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR_Hs_MBD3_ex2 was a gift from Paul Wade (Addgene plasmid # 62623 ; http://n2t.net/addgene:62623 ; RRID:Addgene_62623)