Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p168-759
(Plasmid #62619)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62619 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETM6
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 11125
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    flavaone 3B-hydroxylase
  • Alt name
    CsF3H
  • Species
    Camellia sinensis
  • Insert Size (bp)
    1200
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • GBD (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcaccgaccaccaccctgac
  • 3′ sequencing primer cctcatcttcatcaccggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dihydroflavonol 4-reductase
  • Alt name
    FaDFR
  • Species
    Fragaria ananassa
  • Insert Size (bp)
    1056
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • SH3 (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gggtctgggtgcagaaagcg
  • 3′ sequencing primer cgacgacgtttcggaggcag
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    leucoanthocyanidin reductase
  • Alt name
    DuLAR
  • Species
    Desmodium uncinatum
  • Insert Size (bp)
    1167
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • PDZ (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaccgttagcggtgcaattc
  • 3′ sequencing primer ccaggctttctttaacaccacc
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Scaffold Protein encoding GBD:SH3:PDZ (1:1:4)
  • Alt name
    759
  • Species
    Synthetic
  • Insert Size (bp)
    1704
  • Promoter T7

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ccaaggcagatattggaacacc
  • 3′ sequencing primer cgtcccattcgccaatccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

All genes were cloned in monocistronic form with T7 promoter and T7 terminator.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p168-759 was a gift from Mattheos Koffas (Addgene plasmid # 62619 ; http://n2t.net/addgene:62619 ; RRID:Addgene_62619)
  • For your References section:

    Improvement of catechin production in Escherichia coli through combinatorial metabolic engineering. Zhao S, Jones JA, Lachance DM, Bhan N, Khalidi O, Venkataraman S, Wang Z, Koffas MA. Metab Eng. 2014 Dec 17;28C:43-53. doi: 10.1016/j.ymben.2014.12.002. 10.1016/j.ymben.2014.12.002 PubMed 25527438