p158
(Plasmid
#62617)
-
PurposeePathBrick pETM6 vector encoding CsF3H, CsDFR, and DuLAR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETM6
- Backbone size w/o insert (bp) 5203
- Total vector size (bp) 9155
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameflavaone 3B-hydroxylase
-
Alt nameCsF3H
-
SpeciesCamellia sinensis
-
Insert Size (bp)1200
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- GBD (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gcaccgaccaccaccctgac
- 3′ sequencing primer cctcatcttcatcaccggc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedihydroflavonol 4-reductase
-
Alt nameCsDFR
-
SpeciesCamellia sinensis
-
Insert Size (bp)1074
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- SH3 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gaaagatagcgttgcaagcgc
- 3′ sequencing primer gacgacgtttcggaggcag (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameleucoanthocyanidin reductase
-
Alt nameDuLAR
-
SpeciesDesmodium uncinatum
-
Insert Size (bp)1167
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- PDZ (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gaccgttagcggtgcaattc
- 3′ sequencing primer ccaggctttctttaacaccacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
All genes were cloned in monocistronic form with T7 promoter and T7 terminator.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p158 was a gift from Mattheos Koffas (Addgene plasmid # 62617 ; http://n2t.net/addgene:62617 ; RRID:Addgene_62617) -
For your References section:
Improvement of catechin production in Escherichia coli through combinatorial metabolic engineering. Zhao S, Jones JA, Lachance DM, Bhan N, Khalidi O, Venkataraman S, Wang Z, Koffas MA. Metab Eng. 2014 Dec 17;28C:43-53. doi: 10.1016/j.ymben.2014.12.002. 10.1016/j.ymben.2014.12.002 PubMed 25527438