Skip to main content
Addgene

p148
(Plasmid #62616)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62616 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETM6
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 9155
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    flavaone 3B-hydroxylase
  • Alt name
    CsF3H
  • Species
    Camellia sinensis
  • Insert Size (bp)
    1200
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • GBD (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcaccgaccaccaccctgac
  • 3′ sequencing primer cctcatcttcatcaccggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dihydroflavonol 4-reductase
  • Alt name
    AaDFR
  • Species
    Anthurium andraeanum
  • Insert Size (bp)
    1074
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • SH3 (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gatgcataaaggcaccgtttg
  • 3′ sequencing primer gacgacgtttcggaggcag
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    leucoanthocyanidin reductase
  • Alt name
    DuLAR
  • Species
    Desmodium uncinatum
  • Insert Size (bp)
    1167
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • PDZ (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaccgttagcggtgcaattc
  • 3′ sequencing primer ccaggctttctttaacaccacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

All genes were cloned in monocistronic form with T7 promoter and T7 terminator.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p148 was a gift from Mattheos Koffas (Addgene plasmid # 62616 ; http://n2t.net/addgene:62616 ; RRID:Addgene_62616)
  • For your References section:

    Improvement of catechin production in Escherichia coli through combinatorial metabolic engineering. Zhao S, Jones JA, Lachance DM, Bhan N, Khalidi O, Venkataraman S, Wang Z, Koffas MA. Metab Eng. 2014 Dec 17;28C:43-53. doi: 10.1016/j.ymben.2014.12.002. 10.1016/j.ymben.2014.12.002 PubMed 25527438