-
PurposeLTR7-driving reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT2/BH
- Backbone size w/o insert (bp) 3373
- Total vector size (bp) 5644
-
Vector typeMammalian Expression ; Sleeping Beauty transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLTR7-GFP
-
Insert Size (bp)2000
- Promoter LTR7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCGTGAATTCATGCTGCGAGATGGGAAACA
- 3′ sequencing primer AATCGCTAGCGGGTGAAGGAGAAGGGGTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2/LTR7-GFP was a gift from Zsuzsanna Izsvak (Addgene plasmid # 62541 ; http://n2t.net/addgene:62541 ; RRID:Addgene_62541) -
For your References section:
Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells. Wang J, Xie G, Singh M, Ghanbarian AT, Rasko T, Szvetnik A, Cai H, Besser D, Prigione A, Fuchs NV, Schumann GG, Chen W, Lorincz MC, Ivics Z, Hurst LD, Izsvak Z. Nature. 2014 Dec 18;516(7531):405-9. doi: 10.1038/nature13804. Epub 2014 Oct 15. 10.1038/nature13804 PubMed 25317556