Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmiR-96 cluster promoter
(Plasmid #62517)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62517 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLightSwitch_Prom
  • Backbone manufacturer
    Switchgear Genomics
  • Backbone size w/o insert (bp) 3656
  • Total vector size (bp) 5996
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    promoter of microRNA-183-96-182 cluster
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2340
  • Tag / Fusion Protein
    • RenSP (optimized renilla luciferase gene) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac I (unknown if destroyed)
  • 3′ cloning site Hind III (unknown if destroyed)
  • 5′ sequencing primer TCCATCAAAACAAAACGAAACAA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmiR-96 cluster promoter was a gift from Bharat Ramratnam (Addgene plasmid # 62517 ; http://n2t.net/addgene:62517 ; RRID:Addgene_62517)
  • For your References section:

    Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the beta-Catenin/TCF/LEF-1 pathway in gastric cancer cells. Tang X, Zheng D, Hu P, Zeng Z, Li M, Tucker L, Monahan R, Resnick MB, Liu M, Ramratnam B. Nucleic Acids Res. 2014 Mar;42(5):2988-98. doi: 10.1093/nar/gkt1275. Epub 2013 Dec 13. 10.1093/nar/gkt1275 PubMed 24335145