pcDNA3.1-CHRFAM7ADelta2bp
(Plasmid #62515)

• Purpose: mammalian expression of human duplicated Alpha7 with 2 bp deletion (CHRFAM7A-∆2bp)
• Depositing Labs: Sherry Leonard, Henry Lester
• Publication: Wang et al J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 8000
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CHRFAM7ADelta2bp
• Alt name: dupdeltaAlpha7
• Alt name: Human Alpha7 neuronal nicotinic acetylcholine receptor gene with partial duplication
• Species: H. sapiens (human)
• Insert Size (bp): 1638
• Mutation: partially duplication of CHRNA7 with 2-bp deletion, The 2-bp deletion in exon 6 causes a frameshift in translation, resulting in a smaller gene product, dupΔα7
• GenBank ID: 89832
• Entrez Gene: CHRFAM7A (a.k.a. CHRNA7, CHRNA7-DR1, D-10, NACHRA7)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTCGGTGCCCCTTGCCATTT
• 3′ sequencing primer: CCTTGCCCATCTGTGAGTTTTCCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA