Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-CHRFAM7ADelta2bp
(Plasmid #62515)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62515 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 8000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHRFAM7ADelta2bp
  • Alt name
    dupdeltaAlpha7
  • Alt name
    Human Alpha7 neuronal nicotinic acetylcholine receptor gene with partial duplication
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1638
  • Mutation
    partially duplication of CHRNA7 with 2-bp deletion, The 2-bp deletion in exon 6 causes a frameshift in translation, resulting in a smaller gene product, dupΔα7
  • GenBank ID
    89832
  • Entrez Gene
    CHRFAM7A (a.k.a. CHRNA7, CHRNA7-DR1, D-10, NACHRA7)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCGGTGCCCCTTGCCATTT
  • 3′ sequencing primer CCTTGCCCATCTGTGAGTTTTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CHRFAM7ADelta2bp was a gift from Sherry Leonard & Henry Lester (Addgene plasmid # 62515 ; http://n2t.net/addgene:62515 ; RRID:Addgene_62515)
  • For your References section:

    The duplicated alpha7 subunits assemble and form functional nicotinic receptors with the full-length alpha7. Wang Y, Xiao C, Indersmitten T, Freedman R, Leonard S, Lester HA. J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23. 10.1074/jbc.M114.582858 PubMed 25056953