Skip to main content
Addgene

pBoPyV3-S22
(Plasmid #62368)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62368 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFunnyfarm
  • Backbone manufacturer
    Christopher Buck lab, Addgene plasmid 24755
  • Backbone size w/o insert (bp) 2131
  • Total vector size (bp) 6999
  • Vector type
    Viral clone

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Full genome of BoPyV3 isolate S22
  • Species
    Viruses (Polyomaviridae)
  • Insert Size (bp)
    4868
  • GenBank ID
    KM496326.1 GI:697870369

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer M13/pUC Forward
  • 3′ sequencing primer Asylum-R (CTGAAAGAGGAACTTGGTTAGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genome can be liberated by digestion with EcoRI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBoPyV3-S22 was a gift from Christopher Buck (Addgene plasmid # 62368 ; http://n2t.net/addgene:62368 ; RRID:Addgene_62368)
  • For your References section:

    Hamburger polyomaviruses. Peretti A, FitzGerald PC, Bliskovsky V, Buck CB, Pastrana DV. J Gen Virol. 2015 Jan 7. pii: vir.0.000033. doi: 10.1099/vir.0.000033. 10.1099/vir.0.000033 PubMed 25568187