pJZC39
(Plasmid #62333)

• Purpose: sgRNA + 1x PP7 with mCherry for mammalian cells
• Depositing Labs: Wendell Lim, Stanley Qi
• Publication: Zalatan et al Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.

Backbone

• Vector backbone: MP177_U6 (derived from pSico)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Marked by mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: sgRNA + 1x PP7
• Mutation: Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagatccagtttggttagtaccggg

Gene/Insert 2

• Gene/Insert name: mCherry
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• Supplemental Documents:
  • pJZC39 annotated sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry