Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJZC32
(Plasmid #62327)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62327 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MP177_U6 (derived from pSico)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Marked by mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    sgRNA
  • Mutation
    Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA
  • Promoter U6

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    MCP-VP64
  • Alt name
    MCP RNA binding protein fused to VP64
  • Promoter CMV
  • Tag / Fusion Protein
    • VP64 (C terminal on insert)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJZC32 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 62327 ; http://n2t.net/addgene:62327 ; RRID:Addgene_62327)
  • For your References section:

    Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786