pAN-PBAD-sgRNA-VR
(Plasmid
#62286)
-
Purposeexpression of VR sgRNA from the arabinose-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 3837
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVR sgRNA
-
gRNA/shRNA sequencetgcgctcggtcgttcggctggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt
-
SpeciesSynthetic
- Promoter pBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pBAD-F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAN-PBAD-sgRNA-VR was a gift from Christopher Voigt (Addgene plasmid # 62286 ; http://n2t.net/addgene:62286 ; RRID:Addgene_62286) -
For your References section:
Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Nielsen AA, Voigt CA. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. PubMed 25422271