pJZC620
(Plasmid #62282)

• Purpose: Expresses dCas9, MCP-VP64, and PCP-VP64 in Yeast cells
• Depositing Labs: Wendell Lim, Stanley Qi
• Publication: Zalatan et al Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.

Backbone

• Vector backbone: pNH605
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: MCP-VP64
• Alt name: MCP RNA binding protein fused to VP64
• Promoter: pAdh
• Tag / Fusion Protein:
  • VP64 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: TTTCTGCACAATATTTCAAGC

Gene/Insert 2

• Gene/Insert name: PCP-VP64
• Alt name: PCP RNA binding protein fused to VP64
• Promoter: pAdh
• Tag / Fusion Protein:
  • VP64 (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TTTCTGCACAATATTTCAAGC

Gene/Insert 3

• Gene/Insert name: dCas9
• Mutation: Nuclease activity has been inactivated by mutations in RuvC1 and HNH domains
• Promoter: pTdh3

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGTAGGTATTGATTGTAATTCTG

Resource Information

• Supplemental Documents:
  • pJZC620 annotated sequence
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry