-
Purposemammalian expression of human Alpha7 (CHRNA7)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7200
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHRNA7
-
Alt namehAlpha7
-
Alt nameHuman Alpha7 neuronal nicotinic acetylcholine receptor gene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1638
-
GenBank IDNM_000746.4
-
Entrez GeneCHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCTGCAGCTCCGGGACTCAACATG
- 3′ sequencing primer TGCCCATCTGTGAGTTTTCCACATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CHRNA7 was a gift from Sherry Leonard & Henry Lester (Addgene plasmid # 62276 ; http://n2t.net/addgene:62276 ; RRID:Addgene_62276) -
For your References section:
The duplicated alpha7 subunits assemble and form functional nicotinic receptors with the full-length alpha7. Wang Y, Xiao C, Indersmitten T, Freedman R, Leonard S, Lester HA. J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23. 10.1074/jbc.M114.582858 PubMed 25056953