pAN-PA1-RFP
(Plasmid
#62247)
-
Purposereporter plasmid that encodes one of five synthetic sgRNA-repressible promoters that express mRFP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 4330
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRFP
- Promoter pA1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer RNAde-BB-1F tgccacctgacgtctaagaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAN-PA1-RFP was a gift from Christopher Voigt (Addgene plasmid # 62247 ; http://n2t.net/addgene:62247 ; RRID:Addgene_62247) -
For your References section:
Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Nielsen AA, Voigt CA. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. PubMed 25422271