pCas
(Plasmid #62225)

• Purpose: Constitutive expression of cas9 and inducible expression of lambda RED and sgR
• Depositing Lab: Sheng Yang
• Publication: Jiang et al Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14.

Backbone

• Vector backbone: pKD46
• Backbone size w/o insert (bp): 6300
• Modifications to backbone: Replace Amp with Kan
• Vector type: Bacterial Expression, CRISPR ; Lambda Red recombinase

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Must be grown at 30C! Vector has temperature-sensitive replication (RepA101ts)
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: cas9
• Species: S. pyogenes MGAS5005
• Insert Size (bp): 4500
• Promoter: native cas9 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: pENTR1A-3 (GTAACATCAGAGATTTTGAGACAC)
• 3′ sequencing primer: AraC-F-New (GATGTAGCCGTCAAGTTGTCA)

Resource Information

• Supplemental Documents:
  • Genbank
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 54 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 62225-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here