pAct-Fok1:dCas9
(Plasmid
#62211)
-
PurposeExpresses Fok1:dCas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous high specificity genome engineering in Drosophila melanogaster.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepact
-
Backbone manufacturergift from Silvia Aldaz
- Backbone size w/o insert (bp) 12429
- Total vector size (bp) 17201
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFok1-dCas9
-
Insert Size (bp)4770
- Promoter act5C
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGCAGTCCAAGGAAACCACGC
- 3′ sequencing primer TGTCCAATTATGTCACACCACAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit crisprflydesign.org for more information.
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct-Fok1:dCas9 was a gift from Simon Bullock (Addgene plasmid # 62211 ; http://n2t.net/addgene:62211 ; RRID:Addgene_62211)
