pAct-Cas9
(Plasmid #62209)

• Purpose: Expresses Cas9 under control of act5C promoter and SV40 3'UTR. For ubiquitous genome engineering in Drosophila melanogaster.
• Depositing Lab: Simon Bullock
• Publication: Port et al Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500.

Backbone

• Vector backbone: pact
• Backbone manufacturer: gift from Silvia Aldaz
• Backbone size w/o insert (bp): 12429
• Total vector size (bp): 16571
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: cas9
• Promoter: act5C

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGTAGACCAGCGCAGTCCAAGG
• 3′ sequencing primer: TAGAGCTTTAAATCTCTGTAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hCas9 from George Church (Addgene plasmid 41815).
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit crisprflydesign.org for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.