Skip to main content

pAct-Cas9
(Plasmid #62209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pact
  • Backbone manufacturer
    gift from Silvia Aldaz
  • Backbone size w/o insert (bp) 12429
  • Total vector size (bp) 16571
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cas9
  • Promoter act5C

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTAGACCAGCGCAGTCCAAGG
  • 3′ sequencing primer TAGAGCTTTAAATCTCTGTAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hCas9 from George Church (Addgene plasmid 41815).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit crisprflydesign.org for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAct-Cas9 was a gift from Simon Bullock (Addgene plasmid # 62209 ; http://n2t.net/addgene:62209 ; RRID:Addgene_62209)
  • For your References section:

    Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Port F, Chen HM, Lee T, Bullock SL. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. 10.1073/pnas.1405500111 PubMed 25002478