pnos-Cas9-nos
(Plasmid #62208)

• Purpose: Expresses Cas9 under control of nanos promoter and 3'UTR. For germ line restricted genome engineering in Drosophila melanogaster.
• Depositing Lab: Simon Bullock
• Publication: Port et al Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500.

Backbone

• Vector backbone: pnos
• Backbone manufacturer: Johannes Bischof and Konrad Basler
• Backbone size w/o insert (bp): 9200
• Total vector size (bp): 13353
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: cas9
• Promoter: nanos

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATAAAGAAGTATCGCGAATAC
• 3′ sequencing primer: TTACTATCTATCTGGTTAACCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hCas9 from George Church (Addgene plasmid 41815). pnos backbone from Johannes Bischof and Konrad Basler.
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit crisprflydesign.org for more information.

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.