-
PurposeChr.13/CLYBL TALEN expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepZT
- Backbone size w/o insert (bp) 4681
- Total vector size (bp) 5871
-
Modifications to backboneCompatible with Golden Gate TALEN kit
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRight CLYBL TALEN
-
SpeciesSynthetic
-
Insert Size (bp)2907
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TCGCGAAGAGAGGGGGAGTAAC
- 3′ sequencing primer ACCAAGACATGCCAACGCCACC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pZT-C13/CLYBL TALENs were assembled using RVD monomers from Golden Gate TALEN kit 1.0 (TALEN Kit #1000000016) and a mammalian TALEN expression vector pZT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZT-C13-R1 was a gift from Jizhong Zou (Addgene plasmid # 62197 ; http://n2t.net/addgene:62197 ; RRID:Addgene_62197) -
For your References section:
Transcription activator-like effector nuclease (TALEN)-mediated CLYBL targeting enables enhanced transgene expression and one-step generation of dual reporter human induced pluripotent stem cell (iPSC) and neural stem cell (NSC) lines. Cerbini T, Funahashi R, Luo Y, Liu C, Park K, Rao M, Malik N, Zou J. PLoS One. 2015 Jan 14;10(1):e0116032. doi: 10.1371/journal.pone.0116032. eCollection 2015. PONE-D-14-41442 [pii] PubMed 25587899