pZT-C13-R1
(Plasmid #62197)

• Purpose: Chr.13/CLYBL TALEN expression vector
• Depositing Lab: Jizhong Zou
• Publication: Cerbini et al PLoS One. 2015 Jan 14;10(1):e0116032. doi: 10.1371/journal.pone.0116032. eCollection 2015.

Backbone

• Vector backbone: pZT
• Backbone size w/o insert (bp): 4681
• Total vector size (bp): 5871
• Modifications to backbone: Compatible with Golden Gate TALEN kit
• Vector type: TALEN

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Right CLYBL TALEN
• Species: Synthetic
• Insert Size (bp): 2907
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: TCGCGAAGAGAGGGGGAGTAAC
• 3′ sequencing primer: ACCAAGACATGCCAACGCCACC

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Cellectis Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pZT-C13/CLYBL TALENs were assembled using RVD monomers from Golden Gate TALEN kit 1.0 (TALEN Kit #1000000016) and a mammalian TALEN expression vector pZT