pRS316 GAL cluster
(Plasmid #61925)

• Purpose: Expression of GAL1 and GAL10 from S. cerevisiae cloned into pRS316
• Depositing Lab: Jon Houseley
• Publication: Cruz et al Elife. 2014 Feb 11;3:e01581. doi: 10.7554/eLife.01581.

Backbone

• Vector backbone: pRS316
• Total vector size (bp): 10066
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: GAL1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1587
• Entrez Gene: GAL1 (a.k.a. YBR020W)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GAL1 (AATATACCTCTATACTTTAACGTC)
• 3′ sequencing primer: T7

Gene/Insert 2

• Gene/Insert name: GAL10
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2100
• GenBank ID: NM_001178367.1
• Entrez Gene: GAL10 (a.k.a. YBR019C)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Gal10pro-F (GGTGGTAATGCCATGTAATATG)
• 3′ sequencing primer: M13-R

Resource Information

• Supplemental Documents:
  • pRS316 GAL cluster

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry