pVITRO1-dV-IgE/κ
(Plasmid #61878)

• Purpose: Human immunoglobulin epsilon antibody expression vector (kappa light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) colonies
• Depositing Lab: Andrew Beavil
• Publication: Dodev et al Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885.

Backbone

• Vector backbone: pVITRO1-hygro-mcs
• Backbone manufacturer: InvivoGen
• Backbone size w/o insert (bp): 6491
• Total vector size (bp): 8232
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Human immunoglobulin Epsilon constant region
• Species: H. sapiens (human)
• Insert Size (bp): 1362
• Mutation: Deleted Variable region
• Promoter: mEF1 Prom

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTTTGAGCGGAGCTAATTCTCGGG
• 3′ sequencing primer: AAAAAACCTCCCACACCTCC

Gene/Insert 2

• Gene/Insert name: Human immunoglobulin kappa constant region
• Species: H. sapiens (human)
• Insert Size (bp): 399
• Mutation: Deleted Variable region
• Promoter: rEF1 Prom

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GAGGCTAATTCTCAAGCCTC
• 3′ sequencing primer: TCTAGACCTGGAAAGACCAG

Resource Information

• Supplemental Documents:
  • pVITRO1-dV-IgE/κ

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry