pInducer21 Flag-Sesn2 419A/422A/426A
(Plasmid
#61870)
-
PurposeDox inducible lentivirial expression of Flag-Sesn 419A/422A/426A (mouse) mutant
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepInducer21
- Backbone size w/o insert (bp) 13000
- Total vector size (bp) 14400
-
Vector typeMammalian Expression
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSesn2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1440
-
Mutation419A/422A/426A
-
Entrez GeneSesn2 (a.k.a. HI95, SEST2, Ses2)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pInducer20 5 Primer: aagtgaaagtcgagctcggta (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer21 Flag-Sesn2 419A/422A/426A was a gift from Ming Li (Addgene plasmid # 61870 ; http://n2t.net/addgene:61870 ; RRID:Addgene_61870) -
For your References section:
Sestrins function as guanine nucleotide dissociation inhibitors for Rag GTPases to control mTORC1 signaling. Peng M, Yin N, Li MO. Cell. 2014 Sep 25;159(1):122-33. doi: 10.1016/j.cell.2014.08.038. 10.1016/j.cell.2014.08.038 PubMed 25259925