PRK5-FLAG-Bag6ΔUBL
(Plasmid #61837)

• Purpose: express N-terminally FLAG tagged human Bag6 without UBL domain
• Depositing Lab: Yihong Ye
• Publication: Liu et al Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.

Backbone

• Vector backbone: pRK5
• Backbone size w/o insert (bp): 5204
• Total vector size (bp): 8325
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bag6
• Alt name: BCL2-associated athanogene 6
• Alt name: G3; BAT3; BAG-6; D6S52E
• Species: H. sapiens (human)
• Insert Size (bp): 3138
• GenBank ID: protein reference sequence P46379-1.
• Entrez Gene: BAG6 (a.k.a. BAG-6, BAT3, D6S52E, G3)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTCTAGCATTTAGGTGAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.