PRK5-FLAG-Bag6
(Plasmid #61836)

• Purpose: express N-terminally FLAG tagged human Bag6
• Depositing Lab: Yihong Ye
• Publication: Liu et al Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.

Backbone

• Vector backbone: pRK5
• Backbone size w/o insert (bp): 5204
• Total vector size (bp): 8586
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bag6
• Alt name: BCL2-associated athanogene 6
• Alt name: G3; BAT3; BAG-6; D6S52E
• Species: H. sapiens (human)
• Insert Size (bp): 3423
• GenBank ID:
• Entrez Gene: BAG6 (a.k.a. BAG-6, BAT3, D6S52E, G3)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTCTAGCATTTAGGTGAC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results found a S719N mutation compared to BAG6 isoform b (GenBank ID NP_001092004.1). This mutation may have been present in the original source of the gene; however, the mutation does not affect the protein’s chaperone activity as tested in vitro. See associated publication for more details.