Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSNAPf-AP
(Plasmid #61830)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61830 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAG32
  • Backbone manufacturer
    Euroscarf
  • Backbone size w/o insert (bp) 4160
  • Total vector size (bp) 4781
  • Vector type
    Bacterial Expression, Yeast Expression ; PCR template
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNAP-AP
  • Alt name
    SNAP-SiMPull tag
  • Alt name
    in vivo biotinylated SNAP tag
  • Alt name
    SNAPf-ecAP
  • Insert Size (bp)
    609

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer Sp6-primer: 5' ATTTAGGTGACACTATAG 3'
  • 3′ sequencing primer 5' GACACATGCAGCTCCCGGAGACGGTC 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSNAPf-AP was a gift from Aaron Hoskins (Addgene plasmid # 61830 ; http://n2t.net/addgene:61830 ; RRID:Addgene_61830)
  • For your References section:

    Rapid isolation and single-molecule analysis of ribonucleoproteins from cell lysate by SNAP-SiMPull. Rodgers ML, Paulson J, Hoskins AA. RNA. 2015 May;21(5):1031-41. doi: 10.1261/rna.047845.114. Epub 2015 Mar 24. 10.1261/rna.047845.114 PubMed 25805862