Skip to main content
Addgene

pCDNA-gp78-FLAG RING mutant C356G H361A
(Plasmid #61751)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61751 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDNA3
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7332
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gp78
  • Alt name
    AMFR, RNF45
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1932
  • Mutation
    C356G H361A; P179L, F262L, Y315C, and D346G (please see depositor comment below)
  • GenBank ID
    NM_001144.5
  • Entrez Gene
    AMFR (a.k.a. GP78, RNF45)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Wierds's Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutations P179L, F262L, Y315C, and D346G found during Addgene's quality control process have no affect on plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA-gp78-FLAG RING mutant C356G H361A was a gift from Yihong Ye (Addgene plasmid # 61751 ; http://n2t.net/addgene:61751 ; RRID:Addgene_61751)

  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410
Related items:
Commonly requested with: