PRK5-FLAG-USP13/5-6
(Plasmid
#61748)
-
Purposeexpress N-terminally FLAG tagged human chimera USP13/5-6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 5204
- Total vector size (bp) 7768
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP13/5-6 chimera
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2565
-
MutationUSP13 (1-721aa) fused to USP5 (717-859aa); D23Y in USP13-please see depositor comment below
-
GenBank IDNM_001098536.1 NM_003940.2
-
Entrez GeneUSP5 (a.k.a. ISOT)
-
Entrez GeneUSP13 (a.k.a. ISOT3, IsoT-3)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTCTAGCATTTAGGTGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mutation D23Y in USP13 does not affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRK5-FLAG-USP13/5-6 was a gift from Yihong Ye (Addgene plasmid # 61748 ; http://n2t.net/addgene:61748 ; RRID:Addgene_61748) -
For your References section:
USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410