Skip to main content
Addgene

pTY-EF1a-mKdm2b (del CxxC domain)-Flag
(Plasmid #61740)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61740 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTY
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kdm2b
  • Species
    M. musculus (mouse)
  • Mutation
    delete aa 588-624
  • Entrez Gene
    Kdm2b (a.k.a. Cxxc2, Fbl10, Fbxl1, Fbxl10, Jhdm1b, PCCX2)
  • Promoter EF1a
  • Tag / Fusion Protein
    • Flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer attctcaagcctcagacagtgg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTY-EF1a-mKdm2b (del CxxC domain)-Flag was a gift from Yi Zhang (Addgene plasmid # 61740 ; http://n2t.net/addgene:61740 ; RRID:Addgene_61740)

  • For your References section:

    Kdm2b maintains murine embryonic stem cell status by recruiting PRC1 complex to CpG islands of developmental genes. He J, Shen L, Wan M, Taranova O, Wu H, Zhang Y. Nat Cell Biol. 2013 Apr;15(4):373-84. doi: 10.1038/ncb2702. Epub 2013 Mar 17. 10.1038/ncb2702 PubMed 23502314
Related items:
Commonly requested with: