-
PurposeExpress Hoxa9 and MeisI to induce leukemic transformation. GFP label transduced cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTY
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHoxa9-MeisI-GFP
-
SpeciesM. musculus (mouse)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer attctcaagcctcagacagtgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTY-EF1a-Hoxa9-p2a-MeisI-p2a-GFP was a gift from Yi Zhang (Addgene plasmid # 61738 ; http://n2t.net/addgene:61738 ; RRID:Addgene_61738) -
For your References section:
KDM2b/JHDM1b, an H3K36me2-specific demethylase, is required for initiation and maintenance of acute myeloid leukemia. He J, Nguyen AT, Zhang Y. Blood. 2011 Apr 7;117(14):3869-80. doi: 10.1182/blood-2010-10-312736. Epub 2011 Feb 10. 10.1182/blood-2010-10-312736 PubMed 21310926
Map uploaded by the depositor.