pEFIRES NQO1 WT
(Plasmid #61735)

• Purpose: Expresses WT human NQO1
• Depositing Lab: Yosef Shaul
• Publication: Asher et al Genes Dev. 2005 Feb 1;19(3):316-21.

Backbone

• Vector backbone: pEFIRES
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NAD(P)H dehydrogenase, quinone 1 (NQO1)
• Species: H. sapiens (human)
• Insert Size (bp): 825
• Mutation: wild type
• GenBank ID: NM_000903.2 NP_000894.1
• Entrez Gene: NQO1 (a.k.a. DHQU, DIA4, DTD, NMOR1, NMORI, QR1)
• Promoter: EF1a
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGTTTCTGATAGGCACCTATTGC
• 3′ sequencing primer: CCTTATTCCAAGCGGCTTCGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry