Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEFIRES NQO1 WT
(Plasmid #61735)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61735 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEFIRES
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NAD(P)H dehydrogenase, quinone 1 (NQO1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    825
  • Mutation
    wild type
  • GenBank ID
    NM_000903.2 NP_000894.1
  • Entrez Gene
    NQO1 (a.k.a. DHQU, DIA4, DTD, NMOR1, NMORI, QR1)
  • Promoter EF1a
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGTTTCTGATAGGCACCTATTGC
  • 3′ sequencing primer CCTTATTCCAAGCGGCTTCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEFIRES NQO1 WT was a gift from Yosef Shaul (Addgene plasmid # 61735 ; http://n2t.net/addgene:61735 ; RRID:Addgene_61735)
  • For your References section:

    A mechanism of ubiquitin-independent proteasomal degradation of the tumor suppressors p53 and p73. Asher G, Tsvetkov P, Kahana C, Shaul Y. Genes Dev. 2005 Feb 1;19(3):316-21. 10.1101/gad.319905 PubMed 15687255