pPd4E-ISH
(Plasmid
#61700)
-
PurposePlum eIF4E ihp-RNA construct
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHellsGate12
- Backbone size w/o insert (bp) 17680
-
Vector typeRNAi
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePdeIF4E
-
SpeciesPlum
-
Insert Size (bp)350
- Promoter 35S
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTTCGCAAGACCTTCCTCT
- 3′ sequencing primer GTAAATGCTCCAGAACTCCTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPd4E-ISH was a gift from Lining Tian (Addgene plasmid # 61700 ; http://n2t.net/addgene:61700 ; RRID:Addgene_61700) -
For your References section:
Silencing of the host factor eIF(iso)4E gene confers plum pox virus resistance in plum. Wang X, Kohalmi SE, Svircev A, Wang A, Sanfacon H, Tian L. PLoS One. 2013;8(1):e50627. doi: 10.1371/journal.pone.0050627. Epub 2013 Jan 28. PONE-D-12-26441 [pii] PubMed 23382802
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/61/61700/61700-map_pGJwm4mA4hfz.png.940x940_q85_autocrop.png)