-
PurposeThe human DPYD was used to study the effect of DPYD expression on EMT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJC2
- Backbone size w/o insert (bp) 7347
- Total vector size (bp) 10512
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDihydropyrimidine dehydrogenase
-
Alt nameDPYD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3165
-
GenBank IDNM_000110.3 NM_001160301.1
-
Entrez GeneDPYD (a.k.a. DHP, DHPDHASE, DPD, DYPD)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
- 3′ sequencing primer CCCTTTTCTTTTAAAATTGTGGATGAATACTGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byORFeome
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DPYD-FLAG was a gift from David Sabatini (Addgene plasmid # 61616 ; http://n2t.net/addgene:61616 ; RRID:Addgene_61616) -
For your References section:
Dihydropyrimidine accumulation is required for the epithelial-mesenchymal transition. Shaul YD, Freinkman E, Comb WC, Cantor JR, Tam WL, Thiru P, Kim D, Kanarek N, Pacold ME, Chen WW, Bierie B, Possemato R, Reinhardt F, Weinberg RA, Yaffe MB, Sabatini DM. Cell. 2014 Aug 28;158(5):1094-109. doi: 10.1016/j.cell.2014.07.032. 10.1016/j.cell.2014.07.032 PubMed 25171410