pcDNA-flag-mKdm4d(H189A)-polyA
(Plasmid #61554)

• Purpose: For mRNA synthesis or expression in mammalian cells
• Depositing Lab: Yi Zhang
• Publication: Matoba et al Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30.

Backbone

• Vector backbone: pcDNA
• Backbone size w/o insert (bp): 5700
• Total vector size (bp): 7238
• Modifications to backbone: flag and polyA sequences were added to 5' and 3' side of insert, respectively.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Kdm4d (catalytic mutant)
• Alt name: Jmjd2d (catalytic mutant)
• Species: M. musculus (mouse)
• Insert Size (bp): 1527
• Mutation: changed Histidine 189 (of Kdm4d) to Alanine
• Promoter: CMV and T7
• Tag / Fusion Protein:
  • flag (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cactgcttactggcttatcg
• 3′ sequencing primer: cgtttacaggttctttggtg

Resource Information

• Supplemental Documents:
  • Synthesis of mouse Kdm4d mRNA for microinjection

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry