pcDNA3.1+-pHlash
(Plasmid
#61552)
-
PurposeExpression of pHlash in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7108
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepHlash
-
Alt nameRluc8-cpVenus
-
SpeciesSynthetic
-
Insert Size (bp)1680
- Promoter CMV
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGGATCCAATGGCTTCCAAGGTGTACGA
- 3′ sequencing primer CGCGAATTCTTACTCGATGTTGTGGCGGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Fusion components were requested from collaborator sources. The complete vector was constructed by the submitting party.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+-pHlash was a gift from Carl Johnson (Addgene plasmid # 61552 ; http://n2t.net/addgene:61552 ; RRID:Addgene_61552) -
For your References section:
pHlash: a new genetically encoded and ratiometric luminescence sensor of intracellular pH. Zhang Y, Xie Q, Robertson JB, Johnson CH. PLoS One. 2012;7(8):e43072. doi: 10.1371/journal.pone.0043072. Epub 2012 Aug 14. 10.1371/journal.pone.0043072 PubMed 22905204