TetO-FUW-SOX3
(Plasmid
#61546)
-
PurposeExpresses SOX3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneTetO-FUW
- Backbone size w/o insert (bp) 8376
- Total vector size (bp) 9732
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1356
-
Entrez GeneSOX3 (a.k.a. GHDX, MRGH, PHP, PHPX, SOXB)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGACCACCGCACAGCAAGC
- 3′ sequencing primer TTCCGCCGTGGCAATAGGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-SOX3 was a gift from Rudolf Jaenisch (Addgene plasmid # 61546 ; http://n2t.net/addgene:61546 ; RRID:Addgene_61546) -
For your References section:
Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632