TetO-FUW-mir124a
(Plasmid
#61539)
-
PurposeExpresses mir124a in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTetO-FUW
- Backbone size w/o insert (bp) 8376
- Total vector size (bp) 8688
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemir124a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)312
-
Entrez GeneMIR124-1 (a.k.a. MIR124A, MIR124A1, MIRN124-1, MIRN124A1, mir-124-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGACCACCGCACAGCAAGC
- 3′ sequencing primer TTCCGCCGTGGCAATAGGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymir-124a was obtained from Dr. Gail Mandel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-mir124a was a gift from Rudolf Jaenisch (Addgene plasmid # 61539 ; http://n2t.net/addgene:61539 ; RRID:Addgene_61539) -
For your References section:
Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632