Skip to main content
Addgene

TetO-FUW-DN-REST
(Plasmid #61533)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61533 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8376
  • Total vector size (bp) 11376
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REST
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3000
  • Mutation
    P73, Dominant negative REST (contains the Zf DNA-binding region)
  • GenBank ID
    NM_005612
  • Entrez Gene
    REST (a.k.a. DFNA27, GINGF5, HGF5, NRSF, WT6, XBR)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGACCACCGCACAGCAAGC
  • 3′ sequencing primer TTCCGCCGTGGCAATAGGGA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    DN-REST was obtained from Dr. Gail Mandel. Cell, Vol. 80, 949-957, March 24, 1995,

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-DN-REST was a gift from Rudolf Jaenisch (Addgene plasmid # 61533 ; http://n2t.net/addgene:61533 ; RRID:Addgene_61533)

  • For your References section:

    Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632
Related items:
Commonly requested with: