Skip to main content
Addgene

AIP(WT)-mChF-giantin
(Plasmid #61523)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61523 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    FK506 binding protein 1A
  • Species
    H. sapiens (human)
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • AIP (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    golgin B1
  • Species
    H. sapiens (human)
  • Entrez Gene
    GOLGB1 (a.k.a. GCP, GCP372, GOLIM1)
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer FKBP-F (cacatgccactctcgtcttc)
  • 3′ sequencing primer SV40 poly A Reverse
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Homo sapiens golgin B1 (GOLGB1) encoded in plasmid is 9559-9948 bp NM_001256486.1 cds

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AIP(WT)-mChF-giantin was a gift from Takanari Inoue (Addgene plasmid # 61523 ; http://n2t.net/addgene:61523 ; RRID:Addgene_61523)

  • For your References section:

    Compartmentalized AMPK signaling illuminated by genetically encoded molecular sensors and actuators. Miyamoto T, Rho E, Sample V, Akano H, Magari M, Ueno T, Gorshkov K, Chen M, Tokumitsu H, Zhang J, Inoue T. Cell Rep. 2015 Apr 28;11(4):657-70. doi: 10.1016/j.celrep.2015.03.057. Epub 2015 Apr 16. 10.1016/j.celrep.2015.03.057 PubMed 25892241
Related items:
Commonly requested with: