pCRII_TOPO_hNEAT1
(Plasmid #61518)

• Purpose: human NEAT1_v1 short isoform 3.7kb insert in general cloning vector
• Depositing Lab: Archa Fox
• Publication: Clemson et al Mol Cell. 2009 Mar 27;33(6):717-26. doi: 10.1016/j.molcel.2009.01.026. Epub 2009 Feb 12.

Backbone

• Vector backbone: PCRII
• Backbone manufacturer: Life Technologies
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 7765
• Vector type: general cloning vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NEAT1
• Species: H. sapiens (human)
• Insert Size (bp): 3700
• Mutation: *see comment below
• GenBank ID: NR_028272.1
• Entrez Gene: NEAT1 (a.k.a. LINC00084, NCRNA00084, TP53LC15, TncRNA, VINC)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA.