Skip to main content
Addgene

pBRPyCAG-Mettl3-dsRed-IRES-puro
(Plasmid #61516)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61516 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBRPy
  • Total vector size (bp) 9810
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mettl3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1743
  • Entrez Gene
    Mettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
  • Promoter CAGG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho (destroyed during cloning)
  • 3′ cloning site Not (not destroyed)
  • 5′ sequencing primer GGGGACGGCTGCCTTCGGGG
  • 3′ sequencing primer ACAGGATGTCCCAGGCGAAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBRPyCAG-Mettl3-dsRed-IRES-puro was a gift from Jacob Hanna (Addgene plasmid # 61516 ; http://n2t.net/addgene:61516 ; RRID:Addgene_61516)
  • For your References section:

    Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Geula S, Moshitch-Moshkovitz S, Dominissini D, Mansour AA, Kol N, Salmon-Divon M, Hershkovitz V, Peer E, Mor N, Manor YS, Ben-Haim MS, Eyal E, Yunger S, Pinto Y, Jaitin DA, Viukov S, Rais Y, Krupalnik V, Chomsky E, Zerbib M, Maza I, Rechavi Y, Massarwa R, Hanna S, Amit I, Levanon EY, Amariglio N, Stern-Ginossar N, Novershtern N, Rechavi G, Hanna JH. Science. 2015 Feb 27;347(6225):1002-6. doi: 10.1126/science.1261417. Epub 2015 Jan 1. 10.1126/science.1261417 PubMed 25569111