Skip to main content
Addgene

ER-ABKAR
(Plasmid #61508)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61508 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AMPK Biosensor
  • Promoter CMV
  • Tag / Fusion Protein
    • ER targeting sequence from CYP450 2C1 (see comments) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert prepared from CYP450-containing plasmid gifted by Xin. ER targeting sequence from CYP450 2C1: ATGGACCCTGTGGTGGTGCTGGGGCTCTGTCTCTCCTGTTTGCTTCTCCTTTCACTCTGGAAACAGAGCTATGGGGG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-ABKAR was a gift from Takanari Inoue & Jin Zhang (Addgene plasmid # 61508 ; http://n2t.net/addgene:61508 ; RRID:Addgene_61508)
  • For your References section:

    Compartmentalized AMPK signaling illuminated by genetically encoded molecular sensors and actuators. Miyamoto T, Rho E, Sample V, Akano H, Magari M, Ueno T, Gorshkov K, Chen M, Tokumitsu H, Zhang J, Inoue T. Cell Rep. 2015 Apr 28;11(4):657-70. doi: 10.1016/j.celrep.2015.03.057. Epub 2015 Apr 16. 10.1016/j.celrep.2015.03.057 PubMed 25892241