RAB14 WT
(Plasmid #61493)

• Purpose: to overexpress wild type RAB14. Vector includes GFP driven by hUbC promoter
• Depositing Lab: Curt Civin
• Publication: Kim et al Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164.

Backbone

• Vector backbone: pWCC43
• Backbone manufacturer: a dual promoter lentivector made by the Civin lab
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RAB14
• Species: H. sapiens (human)
• Insert Size (bp): 801
• GenBank ID: NM_016322
• Entrez Gene: RAB14 (a.k.a. FBP, RAB-14)
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: WCC43-F-seq TTCATTCTCAAGCCTCAGAC
• 3′ sequencing primer: WCC43-R-seq CGGACGCTCGCTGCGCCCTTCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry